article

A telomere is a region of highly repetitive DNA at the end of a linear chromosome that functions as a disposable buffer. Every time linear eukaryotic chromosomes are replicated during late S-phase the DNA polymerase complex is incapable of replicating all the way to the end of the chromosome; if it were not for telomeres, this would quickly result in the loss of useful genetic information, which is needed to sustain a cell's activities.

Nature and function of telomeres


In most prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination. A small fraction of bacterial chromosomes (such as those in Streptomyces and Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions.

The telomere is composed of repeating sequences and various proteins and acts to protect the terminal ends of chromosomes. This prevents chromosomal fraying and prevents the ends of the chromosome from being processed as a double strand DNA break, which could lead to chromosome-to-chromosome telomere fusions. Telomeres are extended by telomerases, specialized reverse transcriptase enzymes that are involved in synthesis of telomeres in humans and many other, but not all, organisms. However, because of DNA replication mechanisms and because TERT expression is repressed in many types of human cells, the telomeres of these cells shrink a little bit every time a cell divides although in other cellular compartments which require extensive cell division, such as stem cells and certain white blood cells, TERT is expressed and telomere length is maintained.

In humans, the telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but are generally GC-rich.

In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

If telomeres become too short, they will potentially unfold from their presumed closed structure. It is thought that the cell detects this uncapping as DNA damage and will enter cellular senescence, growth arrest or apoptosis depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

A study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.

Telomere shortening


"Telomeres" shorten because of the lagging strand phenomenon that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the centre, and considering that all DNA polymerases that have been discovered move from the 3' to 5' direction (polymerizing in the 5'-3' direction) one finds, on the DNA molecule being replicated, a leading and lagging strand.

On the leading strand, DNA polymerase can make a complementary DNA strand without any hurdles because it goes from 3' to 5'. On the other hand, there is a problem when they are expected to move from the 5' to 3' direction in the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a little way ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.

Eventually, the last RNA attaches, and DNA polymerase and DNA ligase come along to convert the RNA (of the primers) to DNA, and seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, they have to have another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand but, it doesn't happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade RNA on the DNA if it is left there. Thus, because they are the ones at the end, a section of telomeres is lost during each cycle of replication.

Extending telomeres


The phenomenon of limited cellular division was first observed by Leonard Hayflick. Significant discoveries were made by the team led by Professor Elizabeth Blackburn at the University of California - San Francisco. In 1998, Geron Corporation developed techniques for extending telomeres, and proved that they prevented cellular senescence.

Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through temporary activation of telomerase (by drugs), or possibly permanently by gene therapy. They reason that this would extend human life. So far these ideas have not been proven in humans. In 2006, Geron corporation's web site indicated that it had at least two candidate drugs able to activate telomerase.

However, it has been hypothesized that there is a tradeoff between cancerous tumor supression and tissue repair capacity, and that by lengthening telomeres we might slow aging and in exchange increase vulnerability to cancer (Weinstein and Ciszek, 2002).

A study done with the worm species Caenorhabditis elegans indicates that lengthening telomeres can extend life. Two groups of worms were created that only differed in telomere length. The worms with the longer telomeres lived 24 days on average, about 20 percent longer than the unmodified worms. A side effect of the longer telomeres was an increased resistance to the effects of heat exposure. The reasons for that effect are unclear. (Joeng, et al., 2004)

Techniques to extend telomeres are useful for tissue engineering, because they permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

In 2003, scientists observed that the telomeres of the long-lived bird species Leach's Storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age. This is considered the first known instance of such behaviour of telomeres.

Telomere sequences


Some known telomere sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous fungii Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
Higher plants Arabidopsis thaliana TTTAGGG
Green algae Chlamydomonas TTTTAGGG
Insects Bombyx mori TTAGG
Roundworms Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA*GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Telomeres and cancer


Telomere maintenance activity is a hallmark in approximately 90% of cancers in almost all mammalian organisms. In humans, cancerous tumors acquire indefinite replicative capacity by over-expressing telomerase. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT), a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids. The mechanism by which ALT is activated is not fully understood because these exchange events are difficult to assess in vivo.

References


Related papers


External links


Repetitive DNA sequences | Chromosomes

Telomer | Telómero | Telomeeri | Télomère | טלומר | Telomer | Telomero | テロメア | Telomera | Telomeer | Telomer (genetyka) | Telômero | Telomer | 端粒

 

This article is licensed under the GNU Free Documentation License. It uses material from the "Telomere".

Home Pageartsbusinesscomputersgameshealthhospitalshomekids & teensnewsphysiciansrecreationreferenceregionalscienceshoppingsocietysportsworld